Clinical Validity Scoring Notes and points | Citations from BabySeq: Roessler 2008 PMID: 18538293 - Variants in CFC1 found in individuals with CHD shown in fig 3. there is author overlap with Bamford 2000, and there was a little more phenotype info in that paper.. c.522delC (Ala175Argfs*56) - extension variant but present in 0.1% of all chromosomes in gnomAD… seems too frequent. F162L is also present in 2% of African/African American chromosomes by gnomAD. Do not score. c.650C>G P217R is present in >2% of AA gnomAD chr, did not score c.362+2T>C - (ie IVS4+2T>C) absent from gnomAD. Reported in 4 individuals - one with TOF, but also had variants in FOXh1 per the caption. Also reported in someone with TA, TOF, and AVC. 433G>A Ala145Thr - >4% overall gnomAD frequency, did not score. 232C>T p.R78W - absent gnoad, observed in individaul with TOF, TGA and CHD. c.-7A>G - absent gnomAD observed in individual with TOF and one with AVC. c.23+6G>C aka IVS1+6G>C absent gnomAd found in individual with AVC E210K is in 5 alleles in gnomAD, not very high frequency in an individual with c.650C>G
Bamford 2000 PMID: 11062482 - LOF variants in patients with heterotaxic phenotypes. Same authors as PMID: 18538293. However, the phenotypic info seems richer here. 334C>T R112C - absent gnomAD found in individual with midline and laterality defects: complex cardiac anomalies, intestinal malrotation, additional features absent corpus callosum, microcephaly. Fig 2 shows abnormal clustering at the cell surface, but to be honest I don’t really see it in the figure. Variant was unable to rescue MZoep zebrafish phenotype. 0.5 POINT + 0.5 FUNCTIONAL = 1 POINT c.552delC - I think this is a typo… prior paper has the variant as 522delC and this variant has high MAF. R189C als reported with different c. nomenclature (per HGMD this variant is 565C>T. Present in 2 alleles in gnomAD. Found in patient with CCA iwth L atrial isomerism, VSD, polysplenia. Variant was able to rescue the mZoep zebrafish phenotype (similar to WT). 0.5 POINT 232C>T p.R78W in Individuals 5-9. Per main text, found in 5 unrelated sporadic patients of African Amercan descent. They all had complex heart defects. Patient 5 with CCA, dextrocardia, DORV, PA, complete AV canal, R78W TAPVR, PDA, R-sided aortic arch, R-isomerism of lungs, intestinal malrotation, asplenia. Patient 6 with HLHS, L-atrial isomerism, dysplasia of mitral valve & L ventricular outflow tract, R-isomerism of lungs, R-sided stomach, extrahepatic biliary atresia, polysplenia. Patient 7 with dextrocardia, TGA, common atrium, VSD, PA. Patient 8 with dextrocardia, ASD, VSD, PDA hypoplastic aortic arch, central liver, omphalocele, abnormal ribs. Patient 9 with membranous VSD and holoprosencephaly. Fig 2 shows abnormal clustering at the cell surface, but to be honest I don’t really see it in the figure. Variant was able to rescue the mZoep zebrafish phenotype (similar to WT). R78W VARIANT REPORTED IN 5 INDIVIDUALS - 5x0.5 = 2.5 POINT but downgrading due to lack of evidence from zebrafish phenotype. 2 POINT
Wang 2011 19853937 - c. G506T p. Gly169Val; c. G517A p. Gly173Arg; c. G658T p. Leu219Phe - variants found in individuals with ASD or VSD… going to skip reviewing further for now since these phenotypes are very common. Goldmuntz 2002 PMID: 11799476 - reports c.552delC which is present at a high gnomAD frequency. Also reports c.361_362+18dupAGGTGGGCACAGGGGTGCGC (absent gnomAD) in an individual with D-TGA and pyloric stenosis. Unclear what the exact effect of this duplication would be, could potentially create a cryptic donor site but the native site is intact. 0.5 VARIANT POINT Cemil Ozcelik 2006 PMID: 17072672 - did not review further; phenotypes were ASDs, too common to score and authors note that gene appears to be infrequent cause of CHD without laterality defects. Gonzales 2020 PMID: 31633655 - c.248G>T; p.(Gly83Val) absent gnomad found in a parent and proband with situs inversus. No structural heart defects noted. 0.5 VARIANT POINT PMID: 17445335 -3 non-synonymous coding variants (c.61A>C N21H, R47Q, and R78W), and 2 intronic variants in CFC1. c.61A>C N21H and c.140G>A N21H are too frequent, both present in 1.7% of total gnomAD chromosomes. R78W is absent gnomADwas found in 2 patients: patient 23 with Left inferior caval vein, double outlet right ventricle, atrioventricular A septal defect, pulmonary stenosis, totally anomalous pulmonary venous return, transverse liver, right sided stomach, asplenia. Patient 42 with Inferior caval vein to base of common atrium, bilateral superior caval H vein, right ventricle dominant atrioventricular septal defect, pulmonary atresia, bilaterally symmetrical pulmonary venous return. RECURRENT VARIANT, SCORED ABOVE PMID: 11964968 - c.61A>C N21H, R47Q found in two brothers with laterality defects, but these variants are in high frequeny in gnomAD (both in 1.7% of total chromosomes) PMID: 10574770 - homozygous mouse knockout shows laterality defects and majority died during the first week of life because of complex cardiac malformations such as malpositioning of the great arteries, and atrial–ventricular septal defects. However, doesn’t match with the human reports of het / dominant variants. PMID: 10521397 - another mouse model, homozygous KOs show laterality defects including heterotaxia, randomization of organ situs, and isomerism of bilaterally asymmetric tissues. ,zebrafish one-eyed pinhead(oep) mutants that have beenrescued partially by mRNA injection display heterotaxia, including randomization of heart looping and pancreas location. So some evidence of heterotaxy but still inconsistent with the inheritance in humans.
2 ADDITIONAL VARIANTS (DUPLICATIONS) IN HGMD, but gene was clinGen curated as no evidence for triplosensitivity. |